tgtttcctgtttactaataaataaggtgacagaaaaaa
The query sequence (length=38) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 9c4d:B | 77 | 38 | 1.0000 | 0.4935 | 1.0000 | 1.38e-15 | |
2 | 9c4d:A | 77 | 38 | 1.0000 | 0.4935 | 1.0000 | 1.38e-15 | |
3 | 9c4c:B | 38 | 38 | 1.0000 | 1.0000 | 1.0000 | 1.38e-15 | |
4 | 9c4c:A | 39 | 38 | 1.0000 | 0.9744 | 1.0000 | 1.38e-15 |