tgtcttcaactgctttcgcatgaagtacctcccaactacttttcctcacacttg
The query sequence (length=54) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5w5y:T | 54 | 54 | 1.0000 | 1.0000 | 1.0000 | 2.69e-24 | 5w64:T, 5w65:T, 5w66:T |
| 2 | 6ruo:T | 50 | 46 | 0.7963 | 0.8600 | 0.9348 | 9.83e-14 | 6rwe:T |
| 3 | 6rql:U | 42 | 35 | 0.6481 | 0.8333 | 1.0000 | 9.83e-14 | |
| 4 | 6rql:T | 42 | 35 | 0.6481 | 0.8333 | 1.0000 | 9.83e-14 | |
| 5 | 6rqh:U | 39 | 32 | 0.5926 | 0.8205 | 1.0000 | 4.57e-12 | |
| 6 | 6rqh:T | 39 | 32 | 0.5926 | 0.8205 | 1.0000 | 4.57e-12 | |
| 7 | 6rrd:U | 48 | 28 | 0.5185 | 0.5833 | 1.0000 | 7.65e-10 |
umich.edu