tgtatgtacaaccgaattcgcgacattgaaattttatatacgcgcctttttttttt
The query sequence (length=56) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7ml2:N | 56 | 56 | 1.0000 | 1.0000 | 1.0000 | 2.19e-25 | |
2 | 7ml2:T | 56 | 56 | 1.0000 | 1.0000 | 1.0000 | 2.19e-25 | |
3 | 7ml1:T | 57 | 57 | 1.0000 | 0.9825 | 0.9825 | 1.02e-23 | |
4 | 7ml1:N | 57 | 57 | 1.0000 | 0.9825 | 0.9825 | 1.02e-23 |