tggtttttatatgttttgttatgtattgtttattttcccttgactgactgactgactgactgactgactgactgactgac
tgtatata
The query sequence (length=88) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6rqc:Y | 88 | 88 | 1.0000 | 1.0000 | 1.0000 | 5.89e-43 | |
| 2 | 6rqc:X | 88 | 88 | 1.0000 | 1.0000 | 1.0000 | 5.89e-43 | |
| 3 | 6wgc:H | 41 | 41 | 0.4659 | 1.0000 | 1.0000 | 7.90e-17 | 6wgg:H, 5zr1:H |
| 4 | 6wgc:G | 41 | 41 | 0.4659 | 1.0000 | 1.0000 | 7.90e-17 | 6wgg:G, 5zr1:G |
| 5 | 7w1m:G | 107 | 41 | 0.4659 | 0.3832 | 1.0000 | 7.90e-17 | |
| 6 | 7w1m:F | 107 | 41 | 0.4659 | 0.3832 | 1.0000 | 7.90e-17 | |
| 7 | 6wgi:H | 34 | 34 | 0.3864 | 1.0000 | 1.0000 | 6.15e-13 | |
| 8 | 6wgi:G | 34 | 34 | 0.3864 | 1.0000 | 1.0000 | 6.15e-13 |
umich.edu