tgccgttacaatgtaacagtggcgggtaatccagagccagacgagcactacgaacaactaatgcctactttacaggc
The query sequence (length=77) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7nz3:L1 | 78 | 77 | 1.0000 | 0.9872 | 1.0000 | 7.02e-37 | 7nz3:N1 |
| 2 | 7nz3:K1 | 78 | 77 | 1.0000 | 0.9872 | 1.0000 | 7.02e-37 | 7nz3:M1 |
| 3 | 7nz2:L1 | 77 | 77 | 1.0000 | 1.0000 | 1.0000 | 7.02e-37 | 7nz2:L2, 7nz2:M1 |
| 4 | 7nz2:K1 | 77 | 77 | 1.0000 | 1.0000 | 1.0000 | 7.02e-37 | 7nz2:K2, 7nz2:N1 |
| 5 | 7nz2:N2 | 76 | 76 | 0.9870 | 1.0000 | 1.0000 | 2.52e-36 | |
| 6 | 7nz2:M2 | 76 | 76 | 0.9870 | 1.0000 | 1.0000 | 2.52e-36 |
umich.edu