tgcatccgtgagtcgagggtaataaacgcagcgcggtttcggtggaagcccctcgttgtttcgccgccgtgacgaag
The query sequence (length=77) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8hih:L | 77 | 77 | 1.0000 | 1.0000 | 1.0000 | 7.02e-37 | |
| 2 | 8hih:K | 77 | 53 | 0.6883 | 0.6883 | 1.0000 | 1.54e-23 |
umich.edu