tctgaatctcttccagcacacatcaggacg
The query sequence (length=30) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8eh8:B | 31 | 30 | 1.0000 | 0.9677 | 1.0000 | 2.57e-11 | 8eh9:B, 8eha:B |
| 2 | 6bjs:B | 31 | 30 | 1.0000 | 0.9677 | 1.0000 | 2.57e-11 | |
| 3 | 6asx:B | 30 | 30 | 1.0000 | 1.0000 | 1.0000 | 2.57e-11 | 8ehf:B, 8ehi:B |
umich.edu