tcctcttgtcaggccggaataactccctataatgcgtgacacggactctacgag
The query sequence (length=54) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7szj:X | 57 | 54 | 1.0000 | 0.9474 | 1.0000 | 2.69e-24 | |
2 | 7khe:X | 54 | 54 | 1.0000 | 1.0000 | 1.0000 | 2.69e-24 | |
3 | 7khb:X | 60 | 57 | 1.0000 | 0.9000 | 0.9474 | 7.54e-20 | |
4 | 7khi:X | 36 | 36 | 0.6667 | 1.0000 | 1.0000 | 2.73e-14 | |
5 | 7khc:Y | 63 | 36 | 0.6667 | 0.5714 | 1.0000 | 2.73e-14 | |
6 | 7khc:X | 63 | 36 | 0.6667 | 0.5714 | 1.0000 | 2.73e-14 | |
7 | 7khb:Y | 64 | 61 | 1.0000 | 0.8438 | 0.8852 | 2.73e-14 | |
8 | 7szj:Y | 49 | 28 | 0.5185 | 0.5714 | 1.0000 | 7.65e-10 | |
9 | 7khi:Y | 28 | 28 | 0.5185 | 1.0000 | 1.0000 | 7.65e-10 | |
10 | 7khe:Y | 46 | 28 | 0.5185 | 0.6087 | 1.0000 | 7.65e-10 |