tatcgtcgttaacaaatgttaatgcctcaa
The query sequence (length=30) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5lej:D | 30 | 30 | 1.0000 | 1.0000 | 1.0000 | 2.57e-11 | 5lek:D, 5lrs:D, 6qwf:D, 6qwh:D, 6qwk:D, 6qwm:D |
| 2 | 5lej:C | 30 | 30 | 1.0000 | 1.0000 | 1.0000 | 2.57e-11 | 5lek:C, 5lrs:C, 6qwf:C, 6qwh:C, 6qwk:C, 6qwm:C |
umich.edu