tatccgctcacaatgccacacgcgctgctcggccg
The query sequence (length=35) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6z9q:L | 48 | 35 | 1.0000 | 0.7292 | 1.0000 | 5.60e-14 | |
| 2 | 7add:L | 35 | 35 | 1.0000 | 1.0000 | 1.0000 | 5.60e-14 | 6z9s:L |
| 3 | 7adb:L | 34 | 34 | 0.9714 | 1.0000 | 1.0000 | 2.01e-13 | 7adc:L, 6z9p:L, 6z9r:L |
| 4 | 6z9t:L | 33 | 33 | 0.9429 | 1.0000 | 1.0000 | 7.24e-13 | |
| 5 | 6tqn:L | 34 | 32 | 0.9143 | 0.9412 | 1.0000 | 2.61e-12 | 6tqo:L |
umich.edu