taacagtggccttattaaatgacttctccatgatctac
The query sequence (length=38) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8ff5:N | 53 | 38 | 1.0000 | 0.7170 | 1.0000 | 1.38e-15 | |
| 2 | 8ff4:N | 85 | 38 | 1.0000 | 0.4471 | 1.0000 | 1.38e-15 | |
| 3 | 8fcu:N | 63 | 38 | 1.0000 | 0.6032 | 1.0000 | 1.38e-15 | |
| 4 | 8fcj:N | 38 | 38 | 1.0000 | 1.0000 | 1.0000 | 1.38e-15 | |
| 5 | 8yha:T | 47 | 29 | 0.7632 | 0.6170 | 1.0000 | 1.39e-10 | |
| 6 | 8rdu:3 | 98 | 28 | 0.7368 | 0.2857 | 1.0000 | 4.98e-10 | |
| 7 | 8bd5:C | 41 | 28 | 0.7368 | 0.6829 | 1.0000 | 4.98e-10 |
umich.edu