BioLiP

>dna
gtttttttctgtctcgtgcctggtgtcttgggtgtaatccc

The query sequence (length=41) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	7xti:T	85	41	1.0000	0.4824	1.0000	3.33e-17
2	7xtd:T	123	41	1.0000	0.3333	1.0000	3.33e-17
3	8jnd:J	153	41	1.0000	0.2680	1.0000	3.33e-17	8jne:J, 8xbt:J, 8xbu:J
4	8jnd:I	156	41	1.0000	0.2628	1.0000	3.33e-17	8jne:I, 8xbt:I, 8xbu:I
5	8jh3:T	159	41	1.0000	0.2579	1.0000	3.33e-17
6	6j50:1	41	41	1.0000	1.0000	1.0000	3.33e-17
7	6j50:0	41	41	1.0000	1.0000	1.0000	3.33e-17
8	6j4w:N	165	41	1.0000	0.2485	1.0000	3.33e-17
9	6j4w:T	171	41	1.0000	0.2398	1.0000	3.33e-17
10	6a5p:N	159	41	1.0000	0.2579	1.0000	3.33e-17
11	6a5p:T	168	41	1.0000	0.2440	1.0000	3.33e-17
12	6a5o:N	169	41	1.0000	0.2426	1.0000	3.33e-17
13	6a5o:T	178	41	1.0000	0.2303	1.0000	3.33e-17	8jh4:T
14	6a5l:1	42	41	1.0000	0.9762	1.0000	3.33e-17	6j4z:1
15	6a5l:0	42	41	1.0000	0.9762	1.0000	3.33e-17	6j4z:0
16	7xti:N	74	40	0.9756	0.5405	1.0000	1.20e-16
17	7xtd:N	112	40	0.9756	0.3571	1.0000	1.20e-16
18	6a5u:1	40	40	0.9756	1.0000	1.0000	1.20e-16
19	6a5u:0	40	40	0.9756	1.0000	1.0000	1.20e-16
20	7wbx:T	150	41	0.9756	0.2667	0.9756	1.55e-15
21	7wbv:T	159	38	0.9268	0.2390	1.0000	1.55e-15
22	7wbv:N	154	38	0.9268	0.2468	1.0000	1.55e-15
23	8he5:T	154	41	0.9756	0.2597	0.9756	1.55e-15	7wbw:T
24	6a5r:T	136	38	0.9268	0.2794	1.0000	1.55e-15
25	8he5:N	142	37	0.9024	0.2606	1.0000	5.57e-15
26	7xse:T	134	36	0.8780	0.2687	1.0000	2.00e-14
27	7xn7:T	53	36	0.8780	0.6792	1.0000	2.00e-14
28	8jh2:0	40	36	0.8780	0.9000	1.0000	2.00e-14
29	6j51:1	36	36	0.8780	1.0000	1.0000	2.00e-14
30	6j51:0	36	36	0.8780	1.0000	1.0000	2.00e-14
31	7wbw:N	149	38	0.9024	0.2483	0.9737	7.20e-14
32	7wbx:N	145	41	0.9268	0.2621	0.9268	1.20e-11
33	6ir9:T	128	30	0.7317	0.2344	1.0000	4.33e-11	6j4z:T, 6j50:T
34	6j4x:T	127	29	0.7073	0.2283	1.0000	1.56e-10	6j4y:T, 6j51:T, 8jh2:T
35	6a5l:T	126	28	0.6829	0.2222	1.0000	5.61e-10	6a5t:T, 6a5u:T

[Back]