gttatccgctcacaatgccacacgcgctgctcgg
The query sequence (length=34) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6tqn:L | 34 | 34 | 1.0000 | 1.0000 | 1.0000 | 1.92e-13 | 6tqo:L |
| 2 | 6z9q:L | 48 | 32 | 0.9412 | 0.6667 | 1.0000 | 2.48e-12 | |
| 3 | 7add:L | 35 | 32 | 0.9412 | 0.9143 | 1.0000 | 2.48e-12 | 6z9s:L |
| 4 | 7adb:L | 34 | 32 | 0.9412 | 0.9412 | 1.0000 | 2.48e-12 | 7adc:L, 6z9p:L, 6z9r:L |
| 5 | 6z9t:L | 33 | 30 | 0.8824 | 0.9091 | 1.0000 | 3.21e-11 |
umich.edu