gtgtttggtgtgtttgggtggtggccgttttcgttgtttttttctgtctcgtgcctggtgtcttgggtgttttccccttg
gcggttttttcgcgggggtctgcgcgttcgtgcgtttttgcggtgcttgtgcaaaagagcggcctcggcaccggg
The query sequence (length=155) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7xsz:N | 155 | 155 | 1.0000 | 1.0000 | 1.0000 | 6.47e-80 | |
2 | 7xsz:T | 166 | 132 | 0.8516 | 0.7952 | 1.0000 | 3.95e-67 | |
3 | 7unc:T | 155 | 127 | 0.7677 | 0.7677 | 0.9370 | 5.22e-51 | |
4 | 6a5o:T | 178 | 127 | 0.7484 | 0.6517 | 0.9134 | 5.26e-46 | 8jh4:T |
5 | 6j4w:T | 171 | 124 | 0.7290 | 0.6608 | 0.9113 | 2.45e-44 | |
6 | 6a5p:T | 168 | 121 | 0.7097 | 0.6548 | 0.9091 | 1.14e-42 | |
7 | 6a5o:N | 169 | 119 | 0.6968 | 0.6391 | 0.9076 | 1.47e-41 | |
8 | 7xtd:T | 123 | 107 | 0.6387 | 0.8049 | 0.9252 | 6.85e-40 | |
9 | 7xtd:N | 112 | 70 | 0.4516 | 0.6250 | 1.0000 | 1.15e-32 | |
10 | 7unc:N | 140 | 73 | 0.4645 | 0.5143 | 0.9863 | 1.15e-32 | |
11 | 7und:T | 131 | 85 | 0.5032 | 0.5954 | 0.9176 | 2.50e-29 | |
12 | 8jh4:N | 166 | 58 | 0.3742 | 0.3494 | 1.0000 | 5.41e-26 | |
13 | 7xt7:T | 126 | 79 | 0.4194 | 0.5159 | 0.8228 | 2.55e-14 | |
14 | 7xsx:T | 108 | 79 | 0.4194 | 0.6019 | 0.8228 | 2.55e-14 |