gtcagaaaaaacgggtttcgaaaacagacagtaactcag
The query sequence (length=39) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8qbk:L | 39 | 39 | 1.0000 | 1.0000 | 1.0000 | 3.98e-16 | 8qbk:V, 8qbl:a, 8qbm:a, 7v9u:D, 7v9u:C, 7v9x:D, 7v9x:G, 7xjg:G |
umich.edu