ggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggcca
The query sequence (length=51) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5zdz:G | 54 | 51 | 1.0000 | 0.9444 | 1.0000 | 1.16e-22 | 5ze0:G, 5ze1:G |
2 | 6oem:J | 57 | 51 | 1.0000 | 0.8947 | 1.0000 | 1.16e-22 | 6oen:J, 6oeo:J, 6oep:J, 6oeq:J, 6oer:J |
3 | 6oem:G | 57 | 51 | 1.0000 | 0.8947 | 1.0000 | 1.16e-22 | 6oen:G, 6oeo:G, 6oep:G, 6oeq:G |
4 | 6cim:J | 52 | 51 | 1.0000 | 0.9808 | 1.0000 | 1.16e-22 | |
5 | 6cim:G | 52 | 51 | 1.0000 | 0.9808 | 1.0000 | 1.16e-22 | |
6 | 6cil:J | 53 | 51 | 1.0000 | 0.9623 | 1.0000 | 1.16e-22 | |
7 | 6cil:G | 53 | 51 | 1.0000 | 0.9623 | 1.0000 | 1.16e-22 | |
8 | 6cik:G | 51 | 51 | 1.0000 | 1.0000 | 1.0000 | 1.16e-22 | |
9 | 6cg0:G | 60 | 51 | 1.0000 | 0.8500 | 1.0000 | 1.16e-22 | 6cij:G |
10 | 6oer:G | 57 | 51 | 0.9804 | 0.8772 | 0.9804 | 5.38e-21 | |
11 | 5ze2:M | 40 | 39 | 0.7647 | 0.9750 | 1.0000 | 5.42e-16 | |
12 | 5ze2:G | 40 | 39 | 0.7647 | 0.9750 | 1.0000 | 5.42e-16 | |
13 | 6oet:G | 59 | 39 | 0.7647 | 0.6610 | 1.0000 | 5.42e-16 | |
14 | 6cik:M | 39 | 39 | 0.7647 | 1.0000 | 1.0000 | 5.42e-16 | 6oet:M, 5zdz:M, 5ze0:M, 5ze1:M |
15 | 6cg0:M | 41 | 39 | 0.7647 | 0.9512 | 1.0000 | 5.42e-16 | 6cij:M |