ggtcagaaaatcggttgtggtcagctgctgccaccggttaacctccaattctgctgccagcct
The query sequence (length=63) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7kif:O | 63 | 63 | 1.0000 | 1.0000 | 1.0000 | 3.29e-29 | |
| 2 | 7kin:O | 54 | 55 | 0.8571 | 1.0000 | 0.9818 | 1.54e-22 | |
| 3 | 7kim:P | 45 | 45 | 0.7143 | 1.0000 | 1.0000 | 3.34e-19 | |
| 4 | 7kim:O | 45 | 45 | 0.7143 | 1.0000 | 1.0000 | 3.34e-19 | |
| 5 | 7kif:P | 55 | 40 | 0.6349 | 0.7273 | 1.0000 | 2.01e-16 | |
| 6 | 7kin:P | 49 | 55 | 0.7778 | 1.0000 | 0.8909 | 4.35e-13 |
umich.edu