ggtcagaaaatcggttgtggtcagctgctgccaccggttaacctc
The query sequence (length=45) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7kim:P | 45 | 45 | 1.0000 | 1.0000 | 1.0000 | 2.09e-19 | |
| 2 | 7kim:O | 45 | 45 | 1.0000 | 1.0000 | 1.0000 | 2.09e-19 | |
| 3 | 7kif:O | 63 | 45 | 1.0000 | 0.7143 | 1.0000 | 2.09e-19 | |
| 4 | 7kif:P | 55 | 40 | 0.8889 | 0.7273 | 1.0000 | 1.26e-16 | |
| 5 | 7kin:O | 54 | 37 | 0.8222 | 0.6852 | 1.0000 | 5.84e-15 | |
| 6 | 7kin:P | 49 | 33 | 0.7333 | 0.6735 | 1.0000 | 9.78e-13 |
umich.edu