ggcgataacttcgtataatgtatgctatacgaagttatgcgg
The query sequence (length=42) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7rhz:D | 44 | 42 | 1.0000 | 0.9545 | 1.0000 | 9.59e-18 | |
2 | 7rhz:C | 44 | 42 | 1.0000 | 0.9545 | 1.0000 | 9.59e-18 | |
3 | 7rhx:D | 42 | 42 | 1.0000 | 1.0000 | 1.0000 | 9.59e-18 | 7rhx:F |
4 | 7rhx:C | 42 | 42 | 1.0000 | 1.0000 | 1.0000 | 9.59e-18 | 7rhx:E |
5 | 1nzb:C | 37 | 36 | 0.8571 | 0.9730 | 1.0000 | 2.08e-14 | 1nzb:G, 1q3u:C, 1q3u:G |
6 | 1nzb:D | 37 | 35 | 0.8333 | 0.9459 | 1.0000 | 7.47e-14 | 1nzb:H, 1ouq:D, 1ouq:H, 1q3u:D, 1q3u:H, 1q3v:D, 1q3v:H |
7 | 1xo0:D | 35 | 34 | 0.8095 | 0.9714 | 1.0000 | 2.69e-13 | |
8 | 3c29:C | 35 | 34 | 0.8095 | 0.9714 | 1.0000 | 2.69e-13 | 1xns:C, 1xo0:C |
9 | 3c28:D | 34 | 34 | 0.8095 | 1.0000 | 1.0000 | 2.69e-13 | 3c29:D, 3c29:F, 1pvr:D, 1xns:D |
10 | 3c28:C | 34 | 34 | 0.8095 | 1.0000 | 1.0000 | 2.69e-13 | 3c29:E |
11 | 2hoi:C | 35 | 34 | 0.7857 | 0.9429 | 0.9706 | 1.25e-11 | |
12 | 2hof:C | 34 | 34 | 0.7857 | 0.9706 | 0.9706 | 1.25e-11 | 2hoi:E, 1kbu:D |
13 | 8gh8:F | 34 | 34 | 0.7857 | 0.9706 | 0.9706 | 1.25e-11 | 8gh8:H, 2hof:D, 2hoi:D, 2hoi:F, 1kbu:C |