ggaagatcgaaaaaagcacgctaccgcccgcgtgg
The query sequence (length=35) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8pil:B | 36 | 35 | 1.0000 | 0.9722 | 1.0000 | 5.60e-14 | |
| 2 | 8pib:B | 40 | 35 | 1.0000 | 0.8750 | 1.0000 | 5.60e-14 | |
| 3 | 8ph9:A | 36 | 35 | 1.0000 | 0.9722 | 1.0000 | 5.60e-14 | 8pil:A |
| 4 | 8pfg:A | 40 | 35 | 1.0000 | 0.8750 | 1.0000 | 5.60e-14 | 8pib:A |
| 5 | 8pen:B | 38 | 35 | 1.0000 | 0.9211 | 1.0000 | 5.60e-14 | 8phk:B, 8pid:B |
| 6 | 8pen:A | 38 | 35 | 1.0000 | 0.9211 | 1.0000 | 5.60e-14 | 8pfj:A, 8phk:A, 8pid:A |
| 7 | 8pdy:B | 35 | 35 | 1.0000 | 1.0000 | 1.0000 | 5.60e-14 | |
| 8 | 8pdy:A | 35 | 35 | 1.0000 | 1.0000 | 1.0000 | 5.60e-14 | 8pim:A |
umich.edu