gctgccgaagctttccacaagatatataaagccaagaaatcgaaatactttcaagttacggtaagcatat
The query sequence (length=70) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8iue:Y | 70 | 70 | 1.0000 | 1.0000 | 1.0000 | 4.85e-33 | |
| 2 | 8iuh:Y | 81 | 61 | 0.8714 | 0.7531 | 1.0000 | 4.88e-28 | |
| 3 | 8iuh:X | 81 | 60 | 0.8571 | 0.7407 | 1.0000 | 1.76e-27 | |
| 4 | 8iue:X | 74 | 60 | 0.8571 | 0.8108 | 1.0000 | 1.76e-27 | |
| 5 | 8ity:Y | 82 | 60 | 0.8571 | 0.7317 | 1.0000 | 1.76e-27 | |
| 6 | 8ity:X | 82 | 60 | 0.8571 | 0.7317 | 1.0000 | 1.76e-27 |
umich.edu