gctcccagctccctgctggctccgagtgggttctgccgctctcaatgg
The query sequence (length=48) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6gmh:T | 48 | 48 | 1.0000 | 1.0000 | 1.0000 | 4.94e-21 | 6ted:T |
2 | 8w8e:T | 45 | 45 | 0.9375 | 1.0000 | 1.0000 | 2.30e-19 | 8w8f:T |
3 | 8a3y:T | 138 | 45 | 0.9375 | 0.3261 | 1.0000 | 2.30e-19 | |
4 | 7ycx:d | 45 | 45 | 0.9167 | 0.9778 | 0.9778 | 1.07e-17 | |
5 | 8a40:T | 41 | 41 | 0.8542 | 1.0000 | 1.0000 | 3.84e-17 | |
6 | 8oeu:T | 38 | 38 | 0.7917 | 1.0000 | 1.0000 | 1.79e-15 | 8oev:T, 8oew:T |
7 | 8of0:T | 37 | 37 | 0.7708 | 1.0000 | 1.0000 | 6.43e-15 | |
8 | 7b0y:T | 37 | 37 | 0.7708 | 1.0000 | 1.0000 | 6.43e-15 | |
9 | 8p4b:T | 35 | 35 | 0.7292 | 1.0000 | 1.0000 | 8.32e-14 |