BioLiP

>dna
gcgttttaaccgccaaggggattacacccaagacaccaggcacgagacagaaa

The query sequence (length=53) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	7xti:T	85	53	1.0000	0.6235	1.0000	9.44e-24
2	7xtd:T	123	53	1.0000	0.4309	1.0000	9.44e-24
3	7xse:T	134	53	1.0000	0.3955	1.0000	9.44e-24
4	7xn7:T	53	53	1.0000	1.0000	1.0000	9.44e-24
5	7wbv:T	159	53	1.0000	0.3333	1.0000	9.44e-24
6	7wbv:N	154	53	1.0000	0.3442	1.0000	9.44e-24
7	8jnd:J	153	53	1.0000	0.3464	1.0000	9.44e-24	8jne:J, 8xbt:J, 8xbu:J
8	8jnd:I	156	53	1.0000	0.3397	1.0000	9.44e-24	8jne:I, 8xbt:I, 8xbu:I
9	8jh3:T	159	53	1.0000	0.3333	1.0000	9.44e-24
10	6j4w:N	165	53	1.0000	0.3212	1.0000	9.44e-24
11	6j4w:T	171	53	1.0000	0.3099	1.0000	9.44e-24
12	8he5:N	142	53	1.0000	0.3732	1.0000	9.44e-24
13	6a5r:T	136	53	1.0000	0.3897	1.0000	9.44e-24
14	6a5p:N	159	53	1.0000	0.3333	1.0000	9.44e-24
15	6a5p:T	168	53	1.0000	0.3155	1.0000	9.44e-24
16	6a5o:N	169	53	1.0000	0.3136	1.0000	9.44e-24
17	6a5o:T	178	53	1.0000	0.2978	1.0000	9.44e-24	8jh4:T
18	7wbw:N	149	52	0.9811	0.3490	1.0000	3.40e-23
19	7wbx:T	150	53	0.9811	0.3467	0.9811	4.39e-22
20	8he5:T	154	54	1.0000	0.3442	0.9815	4.39e-22	7wbw:T
21	7wbx:N	145	47	0.8868	0.3241	1.0000	2.04e-20
22	6ir9:T	128	47	0.8868	0.3672	1.0000	2.04e-20	6j4z:T, 6j50:T
23	6j4x:T	127	46	0.8679	0.3622	1.0000	7.35e-20	6j4y:T, 6j51:T, 8jh2:T
24	6a5l:T	126	45	0.8491	0.3571	1.0000	2.64e-19	6a5t:T, 6a5u:T
25	6inq:T	125	44	0.8302	0.3520	1.0000	9.51e-19
26	8jnf:J	123	42	0.7925	0.3415	1.0000	1.23e-17
27	8jnf:I	123	42	0.7925	0.3415	1.0000	1.23e-17
28	7xsz:T	166	46	0.8302	0.2651	0.9565	1.59e-16
29	7xsz:N	155	46	0.8302	0.2839	0.9565	1.59e-16
30	7unc:T	155	46	0.8302	0.2839	0.9565	1.59e-16
31	7und:T	131	44	0.7925	0.3206	0.9545	2.06e-15
32	6a5l:1	42	37	0.6981	0.8810	1.0000	7.40e-15	6j4z:1
33	6a5l:0	42	37	0.6981	0.8810	1.0000	7.40e-15	6j4z:0
34	6j50:1	41	36	0.6792	0.8780	1.0000	2.66e-14
35	6j50:0	41	36	0.6792	0.8780	1.0000	2.66e-14
36	7xti:N	74	35	0.6604	0.4730	1.0000	9.58e-14
37	7xtd:N	112	35	0.6604	0.3125	1.0000	9.58e-14
38	6a5u:1	40	35	0.6604	0.8750	1.0000	9.58e-14
39	6a5u:0	40	35	0.6604	0.8750	1.0000	9.58e-14
40	6a5r:N	127	34	0.6415	0.2677	1.0000	3.44e-13
41	8jh2:0	40	31	0.5849	0.7750	1.0000	1.60e-11
42	6j51:1	36	31	0.5849	0.8611	1.0000	1.60e-11
43	6j51:0	36	31	0.5849	0.8611	1.0000	1.60e-11
44	7unc:N	140	30	0.5660	0.2143	1.0000	5.76e-11
45	6inq:N	116	28	0.5283	0.2414	1.0000	7.46e-10
46	6a5l:N	117	28	0.5283	0.2393	1.0000	7.46e-10	6a5t:N, 6a5u:N

[Back]