gccttgaccttccccttgctggaaggtttaacctgtgtgcagtctgacgcggcg
The query sequence (length=54) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6xh7:1 | 54 | 54 | 1.0000 | 1.0000 | 1.0000 | 2.69e-24 | 6xh8:1 |
| 2 | 6xh8:2 | 54 | 55 | 0.9259 | 0.9259 | 0.9091 | 5.87e-16 | |
| 3 | 6xh7:2 | 48 | 34 | 0.6296 | 0.7083 | 1.0000 | 3.54e-13 | |
| 4 | 6ldi:1 | 50 | 28 | 0.5185 | 0.5600 | 1.0000 | 7.65e-10 | |
| 5 | 7c17:1 | 58 | 28 | 0.5185 | 0.4828 | 1.0000 | 7.65e-10 |
umich.edu