gatttgatcgattgagccttccagtccttcgggactggaatttttttgttcggagaactataatgggagctgtcacggat
gca
The query sequence (length=83) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7w5y:1 | 83 | 83 | 1.0000 | 1.0000 | 1.0000 | 3.56e-40 | |
2 | 7w5y:2 | 83 | 59 | 0.7108 | 0.7108 | 1.0000 | 7.81e-27 | |
3 | 7w5w:1 | 63 | 28 | 0.3373 | 0.4444 | 1.0000 | 1.33e-09 | |
4 | 7vwy:1 | 65 | 28 | 0.3373 | 0.4308 | 1.0000 | 1.33e-09 | 7vwz:1 |