gatctggcctgtcttacacagtgctacagactggaacaaaaaccctgcag
The query sequence (length=50) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6dbl:E | 50 | 50 | 1.0000 | 1.0000 | 1.0000 | 4.05e-22 | 6dbq:E, 6dbt:E, 6dbv:E, 6dbw:E, 6dbx:E |
| 2 | 6dbi:F | 50 | 50 | 1.0000 | 1.0000 | 1.0000 | 4.05e-22 | 6dbl:F, 6dbq:F, 6dbt:F, 6dbv:F, 6dbw:F, 6dbx:F, 3jbw:F |
| 3 | 6dbr:F | 34 | 34 | 0.6800 | 1.0000 | 1.0000 | 3.17e-13 | 6dbu:F, 6dbu:H |
| 4 | 6dbr:E | 34 | 34 | 0.6800 | 1.0000 | 1.0000 | 3.17e-13 | 6dbu:E, 6dbu:G |
| 5 | 6dbi:E | 34 | 34 | 0.6800 | 1.0000 | 1.0000 | 3.17e-13 | 3jbw:E |
| 6 | 6dbj:F | 31 | 31 | 0.6200 | 1.0000 | 1.0000 | 1.48e-11 | 6dbj:G, 3jby:F, 3jby:G |
umich.edu