gagttatgaaaactgcacttttcaaacttt
The query sequence (length=30) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5jk0:E | 30 | 30 | 1.0000 | 1.0000 | 1.0000 | 2.57e-11 | 5jk0:G |
| 2 | 5jk0:F | 30 | 29 | 0.9667 | 0.9667 | 1.0000 | 9.23e-11 | |
| 3 | 5jk0:H | 29 | 28 | 0.9333 | 0.9655 | 1.0000 | 3.32e-10 |
umich.edu