cttatctatgtggcttacgtttgcctgtggcttgttgaagttctctggttcacgc
The query sequence (length=55) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8sjd:J | 55 | 55 | 1.0000 | 1.0000 | 1.0000 | 7.68e-25 | 8sjd:G |
| 2 | 8sjd:I | 46 | 46 | 0.8364 | 1.0000 | 1.0000 | 7.74e-20 | 8sjd:F |
umich.edu