ctgtgccgtccgtaacgttgtcgatttttgtattccggggccatgatgccccggcctcattgaa
The query sequence (length=64) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7mib:H | 64 | 64 | 1.0000 | 1.0000 | 1.0000 | 9.35e-30 | |
| 2 | 7mi9:H | 72 | 64 | 1.0000 | 0.8889 | 1.0000 | 9.35e-30 | |
| 3 | 7mi9:G | 80 | 35 | 0.5469 | 0.4375 | 1.0000 | 1.23e-13 | |
| 4 | 7mib:J | 45 | 33 | 0.5156 | 0.7333 | 1.0000 | 1.60e-12 |
umich.edu