ctctgccccgacacagcctcatacgcctcactctttacacacacgg
The query sequence (length=46) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7zxe:T | 46 | 46 | 1.0000 | 1.0000 | 1.0000 | 6.00e-20 | |
| 2 | 7zxe:N | 47 | 46 | 1.0000 | 0.9787 | 1.0000 | 6.00e-20 | |
| 3 | 7zx8:T | 63 | 46 | 1.0000 | 0.7302 | 1.0000 | 6.00e-20 | |
| 4 | 7zx8:N | 63 | 46 | 1.0000 | 0.7302 | 1.0000 | 6.00e-20 | |
| 5 | 7zx7:T | 66 | 46 | 1.0000 | 0.6970 | 1.0000 | 6.00e-20 | |
| 6 | 7zx7:N | 66 | 46 | 1.0000 | 0.6970 | 1.0000 | 6.00e-20 |
umich.edu