ctctgaatctcttccgacgcgccgcgggacg
The query sequence (length=31) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7py7:T | 31 | 31 | 1.0000 | 1.0000 | 1.0000 | 7.59e-12 | |
| 2 | 7py0:T | 34 | 31 | 1.0000 | 0.9118 | 1.0000 | 7.59e-12 | 7py1:T, 7py8:T, 7q0k:T |
| 3 | 7py3:T | 30 | 30 | 0.9677 | 1.0000 | 1.0000 | 2.73e-11 | 7py5:T, 7py6:T, 7pyj:T, 7pyk:T |
umich.edu