ctctatgtcgggtgcggagaaagaggtaatgaaatgg
The query sequence (length=37) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 1lwt:B | 37 | 37 | 1.0000 | 1.0000 | 1.0000 | 4.74e-15 | |
| 2 | 1lwt:C | 37 | 36 | 0.9730 | 0.9730 | 1.0000 | 1.71e-14 | |
| 3 | 1lws:C | 34 | 34 | 0.9189 | 1.0000 | 1.0000 | 2.21e-13 | |
| 4 | 1lws:B | 34 | 34 | 0.9189 | 1.0000 | 1.0000 | 2.21e-13 |
umich.edu