ctatttattgcaattttcgtgccaatttcg
The query sequence (length=30) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5ui5:B | 30 | 30 | 1.0000 | 1.0000 | 1.0000 | 2.57e-11 | 5ui5:O |
| 2 | 5ui5:A | 31 | 30 | 1.0000 | 0.9677 | 1.0000 | 2.57e-11 | 5ui5:N |
| 3 | 8f1k:B | 34 | 28 | 0.9333 | 0.8235 | 1.0000 | 3.32e-10 | |
| 4 | 8f1k:A | 34 | 28 | 0.9333 | 0.8235 | 1.0000 | 3.32e-10 | |
| 5 | 8f1i:B | 33 | 28 | 0.9333 | 0.8485 | 1.0000 | 3.32e-10 |
umich.edu