cgtcatgatcatattattacgccagacaggg
The query sequence (length=31) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8uql:5 | 31 | 31 | 1.0000 | 1.0000 | 1.0000 | 7.59e-12 | 8uqm:5 |
2 | 8e3f:5 | 33 | 31 | 1.0000 | 0.9394 | 1.0000 | 7.59e-12 | 8e5k:5, 8e5o:5, 8e6x:5, 8e6z:5 |