cgtacgacgtcagtcagtcgggaggactgtcctccgg
The query sequence (length=37) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7uik:Y | 37 | 37 | 1.0000 | 1.0000 | 1.0000 | 4.74e-15 | 7uio:B |
2 | 7uik:X | 38 | 37 | 1.0000 | 0.9737 | 1.0000 | 4.74e-15 | 7uio:A |