Home Research COVID-19 Services Publications People Teaching Job Opening News Forum --> -->
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>dna
cgggtttttgttaagggctgtatcactgtgtaagacaggccagat

The query sequence (length=45) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 5zdz:F 45 45 1.0000 1.0000 1.0000 2.09e-19 5ze0:F, 5ze1:F
2 6oem:I 46 45 1.0000 0.9783 1.0000 2.09e-19 6oen:I, 6oeo:I, 6oep:I, 6oeq:I, 6oer:I
3 6cg0:F 46 45 1.0000 0.9783 1.0000 2.09e-19 6cij:F, 6oem:F, 6oen:F, 6oeo:F, 6oep:F, 6oeq:F
4 6oer:F 46 45 0.9778 0.9565 0.9778 9.71e-18
5 6cil:I 37 37 0.8222 1.0000 1.0000 5.84e-15
6 6cil:F 37 37 0.8222 1.0000 1.0000 5.84e-15
7 6cik:I 35 35 0.7778 1.0000 1.0000 7.56e-14
8 6cik:F 35 35 0.7778 1.0000 1.0000 7.56e-14 6cim:F
9 5ze2:F 30 30 0.6667 1.0000 1.0000 4.55e-11
10 6oet:F 50 30 0.6667 0.6000 1.0000 4.55e-11
11 6cg0:L 30 30 0.6667 1.0000 1.0000 4.55e-11 6cij:L, 6oet:L, 5zdz:L, 5ze0:L, 5ze1:L, 5ze2:L
12 6v0v:I 30 29 0.6444 0.9667 1.0000 1.64e-10
13 6v0v:F 30 29 0.6444 0.9667 1.0000 1.64e-10

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • yangzhanglabumich.edu | (734) 647-1549 | 100 Washtenaw Avenue, Ann Arbor, MI 48109-2218