cgggtttttgttaagggctgtatcactgtgcggcgcaggccagatccagg
The query sequence (length=50) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6oet:F | 50 | 50 | 1.0000 | 1.0000 | 1.0000 | 4.05e-22 | |
| 2 | 6oes:F | 35 | 35 | 0.7000 | 1.0000 | 1.0000 | 8.82e-14 | |
| 3 | 6oem:I | 46 | 46 | 0.8200 | 0.8913 | 0.8913 | 1.48e-11 | 6oen:I, 6oeo:I, 6oep:I, 6oeq:I, 6oer:I |
| 4 | 6cg0:F | 46 | 46 | 0.8200 | 0.8913 | 0.8913 | 1.48e-11 | 6cij:F, 6oem:F, 6oen:F, 6oeo:F, 6oep:F, 6oeq:F |
| 5 | 5ze2:F | 30 | 30 | 0.6000 | 1.0000 | 1.0000 | 5.31e-11 | |
| 6 | 5zdz:F | 45 | 30 | 0.6000 | 0.6667 | 1.0000 | 5.31e-11 | 5ze0:F, 5ze1:F |
| 7 | 6cg0:L | 30 | 30 | 0.6000 | 1.0000 | 1.0000 | 5.31e-11 | 6cij:L, 6oet:L, 5zdz:L, 5ze0:L, 5ze1:L, 5ze2:L |
| 8 | 6oer:F | 46 | 29 | 0.5800 | 0.6304 | 1.0000 | 1.91e-10 | |
| 9 | 6cil:I | 37 | 28 | 0.5600 | 0.7568 | 1.0000 | 6.87e-10 | |
| 10 | 6cil:F | 37 | 28 | 0.5600 | 0.7568 | 1.0000 | 6.87e-10 |
umich.edu