Home Research COVID-19 Services Publications People Teaching Job Opening News Forum --> -->
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>dna
cgggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggccagatc

The query sequence (length=57) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 6oem:J 57 57 1.0000 1.0000 1.0000 6.24e-26 6oen:J, 6oeo:J, 6oep:J, 6oeq:J, 6oer:J
2 6oem:G 57 57 1.0000 1.0000 1.0000 6.24e-26 6oen:G, 6oeo:G, 6oep:G, 6oeq:G
3 6cg0:G 60 57 1.0000 0.9500 1.0000 6.24e-26 6cij:G
4 5zdz:G 54 54 0.9474 1.0000 1.0000 2.90e-24 5ze0:G, 5ze1:G
5 6oer:G 57 57 0.9825 0.9825 0.9825 2.90e-24
6 6cil:J 53 53 0.9298 1.0000 1.0000 1.04e-23
7 6cil:G 53 53 0.9298 1.0000 1.0000 1.04e-23
8 6cim:J 52 52 0.9123 1.0000 1.0000 3.75e-23
9 6cim:G 52 52 0.9123 1.0000 1.0000 3.75e-23
10 6cik:G 51 51 0.8947 1.0000 1.0000 1.35e-22
11 6cg0:M 41 41 0.7193 1.0000 1.0000 4.89e-17 6cij:M
12 5ze2:M 40 40 0.7018 1.0000 1.0000 1.76e-16
13 6oet:G 59 55 0.8772 0.8475 0.9091 1.76e-16
14 5ze2:G 40 39 0.6842 0.9750 1.0000 6.33e-16
15 6cik:M 39 39 0.6842 1.0000 1.0000 6.33e-16 6oet:M, 5zdz:M, 5ze0:M, 5ze1:M

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • yangzhanglabumich.edu | (734) 647-1549 | 100 Washtenaw Avenue, Ann Arbor, MI 48109-2218