Home Research COVID-19 Services Publications People Teaching Job Opening News Forum --> -->
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>dna
cggcgataacttcgtataatgtatgctatacgaagttatgcggc

The query sequence (length=44) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 7rhz:D 44 44 1.0000 1.0000 1.0000 7.26e-19
2 7rhz:C 44 44 1.0000 1.0000 1.0000 7.26e-19
3 7rhx:D 42 42 0.9545 1.0000 1.0000 9.39e-18 7rhx:F
4 7rhx:C 42 42 0.9545 1.0000 1.0000 9.39e-18 7rhx:E
5 1nzb:C 37 36 0.8182 0.9730 1.0000 2.03e-14 1nzb:G, 1q3u:C, 1q3u:G
6 1nzb:D 37 35 0.7955 0.9459 1.0000 7.31e-14 1nzb:H, 1ouq:D, 1ouq:H, 1q3u:D, 1q3u:H, 1q3v:D, 1q3v:H
7 1xo0:D 35 34 0.7727 0.9714 1.0000 2.63e-13
8 3c29:C 35 34 0.7727 0.9714 1.0000 2.63e-13 1xns:C, 1xo0:C
9 3c28:D 34 34 0.7727 1.0000 1.0000 2.63e-13 3c29:D, 3c29:F, 1pvr:D, 1xns:D
10 3c28:C 34 34 0.7727 1.0000 1.0000 2.63e-13 3c29:E
11 2hoi:C 35 34 0.7500 0.9429 0.9706 1.22e-11
12 2hof:C 34 34 0.7500 0.9706 0.9706 1.22e-11 2hoi:E, 1kbu:D
13 8gh8:F 34 34 0.7500 0.9706 0.9706 1.22e-11 8gh8:H, 2hof:D, 2hoi:D, 2hoi:F, 1kbu:C

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • yangzhanglabumich.edu | (734) 647-1549 | 100 Washtenaw Avenue, Ann Arbor, MI 48109-2218