cggcagtcgccgtctacctctccaagagcagcatgcgc
The query sequence (length=38) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8ehq:T | 38 | 38 | 1.0000 | 1.0000 | 1.0000 | 1.38e-15 | 8eoe:T, 8eof:T, 8exy:T |
| 2 | 8ej3:T | 32 | 32 | 0.8421 | 1.0000 | 1.0000 | 2.98e-12 |
umich.edu