cgcgggagctatgaccatgattacgaattgc
The query sequence (length=31) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8wpk:I | 38 | 31 | 1.0000 | 0.8158 | 1.0000 | 7.59e-12 | 8wpp:I |
| 2 | 8wpf:I | 41 | 31 | 1.0000 | 0.7561 | 1.0000 | 7.59e-12 | |
| 3 | 8wpe:I | 37 | 31 | 1.0000 | 0.8378 | 1.0000 | 7.59e-12 | |
| 4 | 8wpe:H | 31 | 31 | 1.0000 | 1.0000 | 1.0000 | 7.59e-12 | 8wpf:H, 8wpk:H, 8wpp:H |
umich.edu