cgcccgcttcggggcaaccctgctaatacaaatccggcaatggagtcaagaccaggttcg
The query sequence (length=60) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6ee8:P | 60 | 60 | 1.0000 | 1.0000 | 1.0000 | 1.44e-27 | |
| 2 | 6vvz:P | 62 | 62 | 1.0000 | 0.9677 | 0.9677 | 8.64e-25 | |
| 3 | 6eec:P | 63 | 63 | 1.0000 | 0.9524 | 0.9524 | 4.02e-23 | 6vvx:P |
| 4 | 6edt:P | 65 | 65 | 1.0000 | 0.9231 | 0.9231 | 2.42e-20 | 6vvy:P, 6vw0:P |
| 5 | 6edt:O | 65 | 65 | 1.0000 | 0.9231 | 0.9231 | 2.42e-20 | 6ee8:O, 6eec:O, 6vvx:O, 6vvy:O, 6vvz:O, 6vw0:O |
umich.edu