ccgtgtgtgtaaagagtgaggcgtatgaggctgtgtcggggcagaggcacaacgtttcatacttac
The query sequence (length=66) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7zx7:T | 66 | 66 | 1.0000 | 1.0000 | 1.0000 | 7.52e-31 | |
2 | 7zx7:N | 66 | 66 | 1.0000 | 1.0000 | 1.0000 | 7.52e-31 | |
3 | 7zxe:N | 47 | 47 | 0.7121 | 1.0000 | 1.0000 | 2.74e-20 | |
4 | 7zx8:N | 63 | 47 | 0.7121 | 0.7460 | 1.0000 | 2.74e-20 | |
5 | 7zxe:T | 46 | 46 | 0.6970 | 1.0000 | 1.0000 | 9.87e-20 | |
6 | 7zx8:T | 63 | 46 | 0.6970 | 0.7302 | 1.0000 | 9.87e-20 |