catgtcaaggccgattattttttccccaaaatcgccggtttaaaattccccagaagg
The query sequence (length=57) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8q4d:b | 58 | 57 | 1.0000 | 0.9828 | 1.0000 | 6.24e-26 | 8q4d:e |
| 2 | 8b4h:E | 57 | 57 | 1.0000 | 1.0000 | 1.0000 | 6.24e-26 | 8b4h:G |
| 3 | 8q4d:a | 118 | 55 | 0.9649 | 0.4661 | 1.0000 | 8.07e-25 | 8q4d:d |
| 4 | 8b4h:F | 55 | 55 | 0.9649 | 1.0000 | 1.0000 | 8.07e-25 | 8b4h:H |
umich.edu