cagctccctgctggctccgagtgggttctgccgct
The query sequence (length=35) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8w8e:T | 45 | 35 | 1.0000 | 0.7778 | 1.0000 | 5.60e-14 | 8w8f:T |
| 2 | 8p4b:T | 35 | 35 | 1.0000 | 1.0000 | 1.0000 | 5.60e-14 | |
| 3 | 8of0:T | 37 | 35 | 1.0000 | 0.9459 | 1.0000 | 5.60e-14 | |
| 4 | 8oeu:T | 38 | 35 | 1.0000 | 0.9211 | 1.0000 | 5.60e-14 | 8oev:T, 8oew:T |
| 5 | 6gmh:T | 48 | 35 | 1.0000 | 0.7292 | 1.0000 | 5.60e-14 | 6ted:T |
| 6 | 7b0y:T | 37 | 35 | 1.0000 | 0.9459 | 1.0000 | 5.60e-14 | |
| 7 | 8a40:T | 41 | 35 | 1.0000 | 0.8537 | 1.0000 | 5.60e-14 | |
| 8 | 8a3y:T | 138 | 35 | 1.0000 | 0.2536 | 1.0000 | 5.60e-14 | |
| 9 | 7ycx:d | 45 | 35 | 0.9714 | 0.7556 | 0.9714 | 2.61e-12 |
umich.edu