cactggaagatctgaatttacgggcgcaactatgccgg
The query sequence (length=38) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8uis:T | 38 | 38 | 1.0000 | 1.0000 | 1.0000 | 1.38e-15 | |
| 2 | 8uhd:T | 38 | 32 | 0.8421 | 0.8421 | 1.0000 | 2.98e-12 | 8uhg:T, 8ui0:T |
| 3 | 8uha:T | 38 | 31 | 0.8158 | 0.8158 | 1.0000 | 1.07e-11 | |
| 4 | 8eg8:B | 30 | 28 | 0.7368 | 0.9333 | 1.0000 | 4.98e-10 | |
| 5 | 8eg7:B | 31 | 28 | 0.7368 | 0.9032 | 1.0000 | 4.98e-10 | 8egb:B |
umich.edu