cacagtgctacagactggaacaaaaaccctgcag
The query sequence (length=34) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6dbl:E | 50 | 34 | 1.0000 | 0.6800 | 1.0000 | 1.92e-13 | 6dbq:E, 6dbt:E, 6dbv:E, 6dbw:E, 6dbx:E |
| 2 | 6dbi:F | 50 | 34 | 1.0000 | 0.6800 | 1.0000 | 1.92e-13 | 6dbl:F, 6dbq:F, 6dbt:F, 6dbv:F, 6dbw:F, 6dbx:F, 3jbw:F |
| 3 | 6dbi:E | 34 | 34 | 1.0000 | 1.0000 | 1.0000 | 1.92e-13 | 3jbw:E |
umich.edu