Home Research COVID-19 Services Publications People Teaching Job Opening News Forum --> -->
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>dna
cacaaatccattgacaaaagaaggctaaaagggcatattcct

The query sequence (length=42) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 6psw:P 62 42 1.0000 0.6774 1.0000 9.59e-18
2 6psw:O 62 42 1.0000 0.6774 1.0000 9.59e-18
3 6psv:O 55 42 1.0000 0.7636 1.0000 9.59e-18
4 6psu:O 42 42 1.0000 1.0000 1.0000 9.59e-18
5 6psq:P 50 42 1.0000 0.8400 1.0000 9.59e-18
6 6psq:O 50 42 1.0000 0.8400 1.0000 9.59e-18
7 6oul:P 61 42 1.0000 0.6885 1.0000 9.59e-18
8 6psv:P 50 39 0.9286 0.7800 1.0000 4.46e-16
9 6pss:O 43 42 0.9762 0.9535 0.9762 4.46e-16
10 6pst:O 50 42 0.9762 0.8200 0.9762 1.60e-15
11 6psu:P 37 37 0.8810 1.0000 1.0000 5.77e-15
12 6pst:P 51 42 0.9524 0.7843 0.9524 2.08e-14
13 6pss:P 43 42 0.9524 0.9302 0.9524 2.08e-14
14 6psr:O 36 35 0.8333 0.9722 1.0000 7.47e-14
15 6psr:P 35 34 0.8095 0.9714 1.0000 2.69e-13
16 6oul:Q 56 34 0.8095 0.6071 1.0000 2.69e-13

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • yangzhanglabumich.edu | (734) 647-1549 | 100 Washtenaw Avenue, Ann Arbor, MI 48109-2218