caatgcgacataaaaccattccggtatacgaatcgatataagaataaggggtgaaatt
The query sequence (length=58) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8i24:O | 58 | 58 | 1.0000 | 1.0000 | 1.0000 | 1.78e-26 | |
| 2 | 8i24:P | 52 | 58 | 0.8621 | 0.9615 | 0.8621 | 1.81e-11 |
umich.edu