caagcgcgggtaaacggcgggagtaactatgactctcttaagg
The query sequence (length=43) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8ibw:B | 43 | 43 | 1.0000 | 1.0000 | 1.0000 | 2.52e-18 | |
| 2 | 8ibw:A | 43 | 43 | 1.0000 | 1.0000 | 1.0000 | 2.52e-18 | |
| 3 | 8gh6:T | 67 | 42 | 0.9767 | 0.6269 | 1.0000 | 9.06e-18 | |
| 4 | 8gh6:B | 47 | 42 | 0.9767 | 0.8936 | 1.0000 | 9.06e-18 | |
| 5 | 8ibx:B | 36 | 36 | 0.8372 | 1.0000 | 1.0000 | 1.96e-14 | |
| 6 | 8ibx:A | 33 | 33 | 0.7674 | 1.0000 | 1.0000 | 9.13e-13 |
umich.edu